Re: [ccp4bb] TEV nucleotude sequence with restriction site

- Protein crystallography

Main steps:

- Protein purification
- Crystallisation

Special:

- Programs for crystallography
- X-ray detectors

Basic tutorials:

   - Chemistry
   - Protein
   - Peptide
   - Amino Acids

Xtal community:

- CCP4BB

CCP4bb navigation

CCP4bb <-- 1999 <-- November 1999 <-- 30 November 1999

Previous message:
Subject: Re: TEV nucleotude sequence with restriction site
From: Chun Luo chun {- at -} ACCELAGEN {- dot -} COM
Date: 2009-06-05

Next message:
Subject: Jeff Christensen is out of the office.
From: Jeff Christensen JChristensen {- at -} DECODE {- dot -} COM
Date: 2009-06-06

Subject: Re: TEV nucleotude sequence with restriction site
From: Dima Klenchin klenchin {- at -} FACSTAFF {- dot -} WISC {- dot -} EDU
Date: 2009-06-05

>Does anybody have a TEV-protease-site-coding nucleotide sequence with a
>commonly-used restriction site in it, preferably right at the end?
>Alternatively, does some somebody know of a program to determine all
>equivalent codon permutations for a small coding region, filtered for
>resulting restriction site possibilities? It seems like it would be an
>easy enough script to write...

Our main vectors (His- and His-MBP cleavable fusions) use blunt site right
after TEV site. This way, you are not dependent on whether the same site is
present in your gene and the cloning can be done without introducing any
artefacts (besides Gly leftover). Here is the sequence:

AGTGAAAACCTGTATTTTCAAGGCCT

AGGCCT is a StuI blunt cutter site (cheap and good enzyme) and
GGC is a Gly

So your insert is typically a PCR product that supplies the last letter in
the Gly codon and you have a complete freedom of what follows. Blunt/sticky
directional ligation, if done right, is extremely efficient and you only
need to cut PCR product with one enzyme (no need to phosphorylate primers,
the single non-ligatable joint gets repaired in E.coli).

But then, we have by now almost completely switched to QuickChange cloning
- "clone anything anywhere anytime completely artefact-free" (at least as
long as the final plasmid is not larger than ~ 9 kbp).

Dima

CCP4bb navigation

CCP4bb <-- 1999 <-- November 1999 <-- 30 November 1999

Previous message:
Subject: Re: TEV nucleotude sequence with restriction site
From: Chun Luo chun {- at -} ACCELAGEN {- dot -} COM
Date: 2009-06-05

Next message:
Subject: Jeff Christensen is out of the office.
From: Jeff Christensen JChristensen {- at -} DECODE {- dot -} COM
Date: 2009-06-06